Cos’è il DNA

Il DNA è la molecola in cui sono contenute tutte le istruzioni necessarie a una cellula per sopravvivere e svolgere le proprie funzioni. Il DNA è alla base dell’ereditarietà, ossia della trasmissione delle caratteristiche che rendono un individuo simile ai propri genitori.

La struttura del DNA

Il nome completo del DNA è acido desossiribonucleico (in inglese DeoxyriboNucleic Acid, da cui l’abbreviazione DNA). È costituito da tante unità base che si ripetono, i nucleotidi. Ogni nucleotide contiene una molecola di acido fosforico (gruppo fosfato), uno zucchero (il deossiribosio) e un composto organico chiamato base azotata.

Nel DNA si possono trovare quattro tipi di basi azotate: l’adenina (A), la citosina (C), la guanina (G) e la timina (T). I nucleotidi si legano tra loro a formare un filamento di DNA, in cui si riconosce uno “scheletro” di desossiribosio e fosfato dal quale sporgono le basi azotate. Ciò che rende unico il DNA delle cellule di un organismo è la sequenza dei nucleotidi: i quattro nucleotidi si alternano o si ripetono in ordine non casuale. La sequenza del DNA viene schematizzata usando le iniziali delle basi azotate contenute nei nucleotidi (es. ATGTTTCGGAGCAGCGGGTTA….).

Escludendo il DNA di certi virus, il DNA è sempre formato da due filamenti appaiati. Possiamo immaginarlo come una scala a pioli, dove le barre laterali sono costituite dallo scheletro del DNA e ogni piolo è costituito da due basi azotate, una per ciascun filamento, legate tra di loro. Per via della loro struttura chimica, le basi azotate si appaiano sempre nello stesso modo: l’adenina con la timina e la citosina con la guanina. Si dice che l’adenina è complementare alla timidina, e viceversa, e che la citosina è complementare alla guanina, e viceversa: i due filamenti sono quindi detti complementari.

Il DNA però non assomiglia tanto a una scala di legno come quelle che servono per andare in soffitta, quanto piuttosto alla scala di rappresentanza di un grande palazzo, a una scala elicoidale: ha una struttura a doppia elica.

DNA Acido Deossiribunucleico

Il segreto della vita

La struttura del DNA è stata chiarita solo nel 1953, molto tempo dopo la scoperta dell’esistenza del DNA. Nel 1869, Johann Friedrich Miescher, un biochimico svizzero, aveva purificato una sostanza sconosciuta contenuta nel nucleo delle cellule e l’aveva chiamata “nucleina”. Miescher era certo che non si trattasse di una proteina, ma non sapeva altro sulla natura di questa nuova molecola. Nei decenni successivi, le ricerche di diversi scienziati permisero di accumulare informazioni riguardo alla nucleina, chiamata poi “acido nucleico” e infine DNA.

Negli anni 20 del secolo scorso, Phoebus Levene, un biochimico di origine russa emigrato negli Stati Uniti, comprese che il DNA era fatto di nucleotidi e che ogni nucleotide era fatto da tre componenti, uno zucchero, un gruppo fosfato e una base contenente azoto. Circa 25 anni dopo, Erwin Chargaff, un biochimico austriaco, osservò che la composizione dei nucleotidi variava da una specie all’altra, ma che, in un dato DNA, la quantità di adenina era simile a quella della timina e quella della citosina era simile a quella della guanina.

Gli “indizi” raccolti erano sufficienti per immaginare la struttura del DNA, ma ciò che trasformò l’immaginazione in conoscenza fu una fotografia, la “fotografia 51”. Dopo che alcuni studi avevano rivelato che il DNA era responsabile dell’ereditarietà dei caratteri, molti ricercatori avevano deciso di dedicarsi allo studio di questa molecola. All’Università di Cambridge, due biologi molecolari, James Watson e Francis Crick, utilizzavano modellini dei nucleotidi per ipotizzare come potessero essere organizzati nello spazio.

Per svelare la struttura del DNA, un altro biologo molecolare, Maurice Wilkins, e una chimica, Rosalind Franklin, stavano invece utilizzando la tecnica della cristallografia a raggi X. La ricercatrice ottenne alcune immagini molto nitide, una delle quali, la fotografia 51, mostrava delle macchie disposte a forma di croce. Quando Wilkins, senza il permesso della Franklin, mostrò questa immagine a Watson e Crick, che lavoravano nella stessa università, i due realizzarono che l’unica struttura compatibile con quello già sapevano del DNA e con l’immagine ai raggi X era una struttura a doppia elica.

Certi di avere scoperto “il segreto della vita”, nell’aprile del 1953, Watson e Crick pubblicarono sulla prestigiosa rivista scientifica Nature il modello tridimensionale del DNA. Nel 1962, Watson, Crick e Wilkins ricevettero il premio Nobel per la medicina per le loro scoperte riguardo alla struttura molecolare degli acidi nucleici. Rosalind Franklin, morta di cancro nel 1958, probabilmente a causa della continua esposizione ai raggi X, non vide perciò riconosciuto il suo contributo in questa importante scoperta.

© 2020 MUTAGENS - Associazione Mutagens. Tutti i diritti riservati.

Utilizzando il sito, accetti l'utilizzo dei cookie da parte nostra. maggiori informazioni

Questo sito utilizza i cookie per fornire la migliore esperienza di navigazione possibile. Continuando a utilizzare questo sito senza modificare le impostazioni dei cookie o cliccando su "Accetta" permetti il loro utilizzo.

Chiudi